Entrades

S'estan mostrant les entrades d'aquesta data: març, 2007

Yu Yu Hakusho III --> ls q falten

Imatge
Per fi i, dsprs d'uns quants molts dies, acabo la meva presentació d Yu Yu Hakusho.............YUPI!!!!¡¡¡¡ Ara toka l torn a akells dolents q, x algún motiu........m'han tokat la fibra........wenu, especifiquem ejem: un d'ells MAI M'HA TOCAT NI EM TOKARÀ LA FIBRA...........VALE¿?!!!¡¡¡ L'ODIO, L'ODIO, L'ODIO, L'ODIO.......grrrrrrrrrrrrrrrrr qina ràbia em fa!!¡¡

Xl q fa ls altres......simplement són ls dolents d la temporada i poka cosa més (ls dolentets d la Ciutat malèfica q es volien fer amos dl món no ls poso...............xq són quatre pallassos mb ls noms dels déus xinesos - Suzaku, Genbu, Byakko i Seiryuu - a més.....mai m'han caigut bé, a més, q jo poso a qi ma sembla.....q punyeta!!¡¡)
Més personatges :
És un dels germans pok germans......en Toguro (petit). És l'amor platònic de la Genkai i la va deixar tirada únicament x a conservar la seva força i joventut (weno, vale....tmb com a càstig personal....es podria dir q va passar un mal dia, …

Avui ha estat un dia molt normal.

Imatge
Doncs eso.......l q diu el títol. No ha pssat res d'estrany ni anormal. Realment, recodro pok del dia d'avui..........x exemple, el de cito-histo ha fet un comentari prou graciós: estaba parlant sobre ls canals q comuniken ls cèl·lules dls teixits vegetals.....aleshores ha parlat sobre un mekanisme q tenen akestes x defensar-sen davant agressions com pot ser la posta d'ous dels insectes, xo, pobre home...............no s'ha explikat gaire bé; la seva frase estrella ha estat : - noseqnoseq...blablabla..."si ls insectes hi posen ls ous".....- En l seu moment ha tingut gràcia.....ara, en fred, noseyo...¬¬. El cas és q, el pobre home, ha tornat a perdre ls transparències q se suposa, ha d penjar en la "red".....mai aprèn.....buuuuuff. Ja podeu imaginar, mb la seva frase estrella,q es el q hem pensat tots i el xq d ls nostres rises....jijiji....som humans, som així. A part d'akest petit incís, avui......m'he aburrit na mika, weno, no dl tot, mb el…

Yu Yu Hakusho II --> Friends 'n' company

Imatge
Ja he dit anteriorment q no posaria tots ls peronatges junts...i no per falta d ganes, es q són molts i moltes coses a explikar.....aki en presento uns quants més (no tink imatges d tots xo vaja...jejeje...el q potser faré serà posar una imatge on hi surtin uns kuants d cop o no...xq consultant l meu arxiu...¬¬...eeeejejejejeje
Altres personatges :




Akesta és la Botan, la q encarrega ls missions a en Yusuke. Està com una cabra...literalment. Es dedica a volar xls cels pujada en un rem.....en un rem xq ells és l'encarregada d dur l'ànima dls morts fins al món espiritual...podriem dir q és la mort (o una d ls seves cares). És mol natural i no sol pensar en el q fa.....com tmb és una tafanera i explica alló q sap i el q no, no se sap mossegar la llengua. En Hiei li fa por.......xq com és una bocamolla (i smpr està enganxada a la D.E.A) té por d dir el q no ha d dir i que en Hiei li canti ls del 15...jeje.
El tap de bassa més vell q matusalen, el Príncep Koenma....és qi mou ls fils. …

Yu Yu Hakusho

Imatge
Com ja he dit anteriorment.....he pensat q podria exposar alguns dls animes/mangas q m'agraden.......por eso d no ser solo yo n l blog, m'enteneu no¿?!!!¡¡¡ Doncs començo mb Yu Yu Hakusho...mmmmmmmmmmmmmmhhhhhhhhhhhhh......si espereu q faci un resum d la sèrie o algo per l'estil, aneu bé!!!¡¡¡¡ para eso ta la wikipèdia....¬¬ hombre, vaya jepetto!!!
La sèrie, ja d per si, comença malament.............el protagonista la dinya i resucita...i no un cop, NOOOOOOOOOOOOOOOOOOOOO!!! crec q n'he comptat tres.....resureccions a part, el nano, q no te gaires llums, s'ho munta bé xq li caiguin al damunt un munt d casos superrarosdelahòstia (xq ho són.......a veure qi mb dos dits d front s'en va a buscar una D.E.A -donzella en apuroooooooooos- q plora perles...O.o ya s'ha d ser raro, ya...). El cas es q en akestes èpikes recerques i missions, q per cert li enkarrega un tap de bassa més vell q matusalen, s'hi apunta l seu mmmmmmmmmhhhhhhhh, com dir-ho,AMIC NO-AMIC¿?¿?…

//...\\ -> un dia d llavis tallats <- //...\\

Imatge
Ooooooooooolaaaaaaaaaaaaaa!!!!!!!!!!!!! Torno a ser jo, jejeje!!¡¡ Primer d res, vull confirmar (com ja vaig dir l' últim cop) q el mal d coll no deixa dormir...¬¬...EFECTIVAMENT!!!!¡¡¡¡ tinc un coll q sembla un fregall d cuina, a més d mokos i molts ganes d dormir (nkara q aixó no se si es deu al refredat o a la vagància q porto al damunt......O.o vagància¿?...¬¬ weno, eeeeeeeeeehhhhhhhhh, ja m'enteneu, no¿?!!¡¡), en tot cas, avui estik quelcom espesa....ahh, és clar, com diu l títol d'entrada, mb ls llavis tallats...I MOLT!!¡¡...........com podreu suposar...ningú no em va fer ni cas ahir x la nit, jops.....jo malaltona i la meva familia dormint com tronks, ignorants d'alló q li estava succeïnt al meu fantàstik organisme........Q TRIST!!¡¡

Bé, canviant el tema...avui a la uni...bé, canviant de tema DE NOU.....s q si parlo només cauràn crítiques al profe d Fisio vegetal......i cap constructiva. E l que si us puk explicar s q, d tornada a cas mb la Txell, he vist un "…

.......Catalunya........

Akest poema no és meu...................personalment penso q té molt x millorar, xo weeeeeeeeeeeeno (és normal, ningú sol esforçar-se gaire x segons quins "deures" (no se si m'enteneu jeje);))
Catalunya, la meva pàtria

Catalunya i les quatre barres,
aquesta és la meva bandera
si aquesta ja no hi és, t’ensorres
la meva pàtria és la senyera.

Un perfum de brisa marina,
un munt de festes populars,
i de cançons n’es una mina
i té uns balls espectaculars.

També hi ha un ball que és la Sardana,
el cant dels ocells és famós,
la Sardana es batlla amb rutllana
i el cant alegra tot el cos.

El seu menjar tradicional
és l’escudella catalana,
i és que al final mai et fa mal
ser una molt bona catalana. L'autora/or m'ha demanat q la/el mantingui en l'anonimat (coses d ls escriptores/rs..........són així d'excèntrics elles/s), en tot cas, m'ha donat la llicència x posar el seu pseudònim : Kame-sama. Y HASTA AKI PUEDO LEER!!¡¡ Weno, n el q qeda d tarda, ja em donarà tmps x…

.....I've seen a light......

Imatge
Si, he visto una luz.....................la delTAQ.................efectivament, m'han fet unTAQaket matí i, xq¿? coses d la dentista ^ ^U.......xq no penseu pas q estik amb un peu a l'altre barri, NOOOOOOOOOOOOOOOOOOO!!! enkara hi ha Nalataia x estona jejeje. Com a conseqüència no he nat a la uni..........ui, quina penaaaaaaaaaaaaaa, com a contrapartida m'he qedat a casa i m'he rascat els santíssims!!! Pensava q em farien esperar molt més a la Vall d'Hebron, xo.............10 min tmpk és tan!¡ El cas s q he perdut classe........espero q la Txell ma deixi ls apunts, sinó.....l'hi robaré jeje. En tot cas, he pasat un gran matí, ara, el q és la tarda ¬¬...............PALETES!¡ la meva creu són ls PALETES!¡ tacatacatacatacatacatacatacatacatacatacatacatacatacataca DEUS DE L'OLIMP!!!!!!!!!¡¡¡¡¡¡¡¡¡¡ QUINA "PESADILLA", xo ara smbla q ja han parat una mika.
La veritat s q el dia tmnpk ha donat x més, ah wenu, si....................FRED!!!!!!!!!!!¡¡¡¡¡¡¡¡…

//\\ no todo debe ser desesperanza //\\

Imatge
Vencidos por las lágrimas, locos de cristal piden sangre entre las esquinas...
soñando en aquello que pudo ser roto por el peso de sus vidas.
Marcando el paso, aspectros de barro, cruzando sus ojos sin mirar envuelven su ira entre sedas blancas... luchando entre semejantes por un lugar en el Olimpo
Niños sin vida gritan con labios secos entre las piernas de un cuerpo indiferente... esperanzas perdidas vuelan por encima sus cabezas, llamandoles con murmullos inaudibles.
Quantos silencios rotos por golpes bajos en el torso, quantas horas pasarán antes de despertar... lentos y dolorosos son los lamentos, duras y frias las manos que sostienen vidas efímeras, consumidas son por las llamas, prefacio de aquello por venir ........nos traerá, incluso ahora y así, lo más grande aún por ver........
alma infinita de paz y amor ...madre de todo y todos...
Ja ns llegirem!!!!! Ciao!!!!!

....begin, began, begun.....

Imatge
Mmmmmmmmmmmmhhhh, q bona ta la lasanya d la mama............i q fantastiks sn ls còmics d One Piece jeje. Weno, x aki prop tink ls fotos d cap d'any a casa l'Àngela.....ja m'han dit q no ls penji xo s q no m'hi puc resistir... xq n'hi ha cada una d la Txell q.........jeje.......en tot cas, posarè akelles poc compromeses (vale, ta bé, akelles on no se li veu la cara.....q són pokes si tenim en compte q, bàsicament, li vaig fotografiar la cara, xo weno........xq no sigui dit!!!). Altre cosa.............ahir vaig comentar q faltaven ls fotos dl Saló............i no només akí, sinó tmb n l meu ordinador (si, q passa¿? en vaig fer pokes, alguna queixa!!!¿?) per tant, fins q no ma passin ls altres......no podré fer-hi gaire.................. :'( ho sento!!!
Vaja, aki teniu ls fotos (tmpk penseu q en posaré gairezzzz.................si no em penjaràn, enkara q com gairebé ningú mira l meu blog.....tmpk ve d'aki ^__^ U):


Akesta s la Txell i fa molta por.........teòri…